Combination Of Circular Dichroism Research Articles

Lanmodulin's EF 2-3 Domain: Insights from Infrared Spectroscopy and Simulations.

Lanmodulins are small, ∼110-residue proteins with four EF-hand motifs that demonstrate a picomolar affinity for lanthanide ions, making them efficient in the recovery and separation of these technologically important metals. In this study, we examine the thermodynamic and structural complexities of lanthanide ion binding to a 41-residue domain, EF 2-3, that constitutes the two highest-affinity metal-binding sites in the lanmodulin protein from Methylorubrum extorquens. Using a combination of circular dichroism (CD) spectroscopy, isothermal titration calorimetry (ITC), two-dimensional infrared (2D IR) spectroscopy, and molecular dynamics (MD) simulations, we characterize the metal binding capabilities of EF 2-3. ITC demonstrates that binding occurs between peptide and lanthanides with conditional dissociation constants (Kd) in the range 20-30 μM, with no significant differences in the Kd values for La3+, Eu3+, and Tb3+ at pH 7.4. In addition, CD spectroscopy suggests that only one binding site of EF 2-3 undergoes a significant conformational change in the presence of lanthanides. 2D IR spectroscopy demonstrates the presence of both mono- and bidentate binding configurations in EF 2-3 with all three lanthanides. MD simulations, supported by Eu3+ luminescence measurements, explore these results, suggesting a competition between water-lanthanide and carboxylate-lanthanide interactions in the EF 2-3 domain. These results underscore the role of the core helical bundle of the protein architecture in influencing binding affinities and communication between the metal-binding sites in the full-length protein.

Introducing Aliphatic Fluoropeptides: Perspectives on Folding Properties, Membrane Partition and Proteolytic Stability.

A de novo designed class of peptide-based fluoropolymers composed of fluorinated aliphatic amino acids as main components is reported. Structural characterization provided insights into fluorine-induced alterations on β-strand to α-helix transition upon an increase in SDS content and revealed the unique formation of PPII structures for trifluorinated fluoropeptides. A combination of circular dichroism, fluorescence-based leaking assays and surface enhanced infrared absorption spectroscopy served to examine the insertion and folding processes into unilamellar vesicles. While partitioning into lipid bilayers, the degree of fluorination conducts a decrease in α-helical content. Furthermore, this study comprises a report on the proteolytic stability of peptides exclusively built up by fluorinated amino acids and proved all sequences to be enzymatically degradable despite the degree of fluorination. Herein presented fluoropeptides as well as the distinctive properties of these artificial and polyfluorinated foldamers with enzyme-degradable features will play a crucial role in the future development of fluorinated peptide-based biomaterials.

Characterization of binding interaction between S100A1 and titin's UN2A region.

Titin, the giant sarcomere protein, consists of multiple domains and regions of repeated structural elements that are essential for sarcomeric integrity of the myofibril. The N2A region within titin has been identified as a signaling hub in skeletal muscle that is responsible for various mechanics and interactions in the muscle. The N2A region is located at the junction between the proximal tandem Ig region and the PEVK region and is comprised of four Ig domains and a unique 117 amino acid insertion sequence (UN2A). The insertion sequence resides between the Ig80 and Ig81 domains, and exists in skeletal muscle, as well as the N2AB isoform of cardiac muscle. An analysis of the insertion region sequence revealed a potential binding site for the Ca2+-binding protein S100A1. A combination of circular dichroism and FRET experiments demonstrated the conformational change in UN2A that is induced by S100A1, and can be affected differently due to pH changes. Surface plasmon resonance was used to study the binding kinetics and affinities of this interaction at different pH and pCa values. S100A1's binding to UN2A is calcium-dependent, and the strength of this interaction is affected by pH. The S100A1/UN2A binding interaction has been shown to perturb the structure of UN2A potentially at its stable helical core. The results will provide insight on the nature of this interaction and how it may have a functional role in the muscle.

Mapping DNA Conformations Using Single-Molecule Conductance Measurements.

DNA is an attractive material for a range of applications in nanoscience and nanotechnology, and it has recently been demonstrated that the electronic properties of DNA are uniquely sensitive to its sequence and structure, opening new opportunities for the development of electronic DNA biosensors. In this report, we examine the origin of multiple conductance peaks that can occur during single-molecule break-junction (SMBJ)-based conductance measurements on DNA. We demonstrate that these peaks originate from the presence of multiple DNA conformations within the solutions, in particular, double-stranded B-form DNA (dsDNA) and G-quadruplex structures. Using a combination of circular dichroism (CD) spectroscopy, computational approaches, sequence and environmental controls, and single-molecule conductance measurements, we disentangle the conductance information and demonstrate that specific conductance values come from specific conformations of the DNA and that the occurrence of these peaks can be controlled by controlling the local environment. In addition, we demonstrate that conductance measurements are uniquely sensitive to identifying these conformations in solutions and that multiple configurations can be detected in solutions over an extremely large concentration range, opening new possibilities for examining low-probability DNA conformations in solutions.

Structural and mechanical properties of folded protein hydrogels with embedded microbubbles.

Globular folded proteins are powerful building blocks to create biomaterials with mechanical robustness and inherent biological functionality. Here we explore their potential as advanced drug delivery scaffolds, by embedding microbubbles (MBs) within a photo-activated, chemically cross-linked bovine serum albumin (BSA) protein network. Using a combination of circular dichroism (CD), rheology, small angle neutron scattering (SANS) and microscopy we determine the nanoscale and mesoscale structure and mechanics of this novel multi-composite system. Optical and confocal microscopy confirms the presence of MBs within the protein hydrogel, their reduced diffusion and their effective rupture using ultrasound, a requirement for burst drug release. CD confirms that the inclusion of MBs does not impact the proportion of folded proteins within the cross-linked protein network. Rheological characterisation demonstrates that the mechanics of the BSA hydrogels is reduced in the presence of MBs. Furthermore, SANS reveals that embedding MBs in the protein hydrogel network results in a smaller number of clusters that are larger in size (∼16.6% reduction in number of clusters, 17.4% increase in cluster size). Taken together, we show that MBs can be successfully embedded within a folded protein network and ruptured upon application of ultrasound. The fundamental insight into the impact of embedded MBs in protein scaffolds at the nanoscale and mesoscale is important in the development of future platforms for targeted and controlled drug delivery applications.

Influence of Green Synthesized Zinc Oxide Nanoparticles on Molecular Interaction and Comparative Binding of Azure Dye with Chymotrypsin: Novel Nano-Conjugate for Cancer Phototherapy.

Till date, different types of conventional drugs have been used to fight tumors. However, they have significant flaws, including their usage being constrained because of their low bioavailability, poor supply, and serious side effects. The modern combination therapy has been viewed as a potent strategy for treating serious illnesses, including cancer-type feared diseases. The nanoparticles are a promising choice for cancer therapeutic and diagnostic applications because of their fascinating optoelectronic and physicochemical features. Among the metallic nanoparticles, Zinc oxide nanoparticles possess interesting physicochemical and anti-cancer characteristics, such as ROS generation, high retention, enhanced permeability etc., making them attractive candidates for the treatment and diagnosis of cancer. Zinc oxide nanoparticles showed anti-cancer property via excessive reactive oxygen species (ROS) production, and by the destruction of mitochondrial membrane. Here, we have synthesized organic/inorganic hybrid nanosystem composed of chymotrypsin protein (Chymo) with AzureC (AzC) conjugated with Zinc oxide nanoparticles (ZnONPs). The conjugation of AzureC with ZnONPs was confirmed by transmission electron microscopy (TEM), zeta potential, and dynamic light scattering (DLS) experiment. The interaction of Chymo with AzC alone and AzC-ZnONPs was investigated, and it was observed that the interaction was enhanced in the presence of ZnONPs, which was concluded by the results obtained from different spectroscopic techniques such as UV-Visible spectroscopy, fluorescence spectroscopy and circular dichroism in combination with molecular docking. UV-Visible spectroscopic studies and the corresponding binding parameters showed that the binding of AzC-ZnONPs complex with Chymo is much higher than that of AzC alone. Moreover, the fluorescence measurement showed enhancement in static quenching during titration of Chymo with AzC-ZnONPs as compared to dye alone. In addition to this, circular dichroism results show that the dye and dye-NPs conjugate do not cause much structural change in α-Chymo. The molecular docking and thermodynamic studies showed the predominance of hydrogen bonding, Van der Waal force, and hydrophobic forces during the interactions. After correlation of all the data, interaction of Chymo with AzC-ZnONPs complex showed strong interaction as compared to dye alone. The moderate binding with chymo without any alteration in the structure makes it desirable for the distribution and pharmacokinetics. In addition, the in vitro cytotoxicity of the AzC-ZnONPs was demonstrated on A-549 adenocarcinoma cell line. Our findings from physiochemical investigations suggested that the chymotrypsin coated AzC conjugated ZnONPs could be used as the novel nanoconjugates for various cancer phototherapies.

Enantiopure chiroptical probes for circular dichroism and absorbance based detection of nerve gas simulants

A series of oxovanadium(V) compounds 1-4 were prepared and explored as stereodynamic chiroptical probes to detect a simulant of sarin known as diethyl chlorophosphate (DCP) without any interference from the competing analytes. Simultaneous CD cum UV/vis based bimodal instant recognition of DCP using optically active probes is unprecedented. Upon fabricating the vanadium compound with a polymer has yielded a chiroptical membrane, which showed a change in its dichroic as well as colorimetric signals on interaction with DCP vapour at 1 ppm. EPR and UV/vis studies revealed an irreversible change of the CD-active V(V) to the CD-silent ternary V(V) species in presence of DCP via a transient V(IV) species. Nucleophilic attack of the alkoxo oxygen of 1-4 to the electrophilic P atom of DCP resulted in the formation of ternary V(V) compounds as confirmed by 51V/31P NMR.

Tuning DNA Supramolecular Polymers by the Addition of Small, Functionalized Nucleobase Mimics.

Nucleobase mimicking small molecules able to reconfigure DNA are a recently discovered strategy that promises to extend the structural and functional diversity of nucleic acids. However, only simple, unfunctionalized molecules such as cyanuric acid and melamine have so far been used in this approach. In this work, we show that the addition of substituted cyanuric acid molecules can successfully program polyadenine strands to assemble into supramolecular fibers. Unlike conventional DNA nanostructure functionalization, which typically end-labels DNA strands, our approach incorporates functional groups into DNA with high density using small molecules and results in new DNA triple helices coated with alkylamine or alcohol units that grow into micrometer-long fibers. We find that small changes in the small molecule functional group can result in large structural and energetic variation in the overall assembly. A combination of circular dichroism, atomic force microscopy, molecular dynamics simulations, and a new thermodynamic method, transient equilibrium mapping, elucidated the molecular factors behind these large changes. In particular, we identify substantial DNA sugar and phosphate group deformations to accommodate a hydrogen bond between the phosphate and the small-molecule functional groups, as well as a critical chain length of the functional group which switches this interaction from intra- to interfiber. These parameters allow the controlled formation of hierarchical, hybrid DNA assemblies simply through the addition and variation of small, functionalized molecules.

Molecular Insights into Conformational Heterogeneity and Enhanced Structural Integrity of Helicobacter pylori DNA Binding Protein Hup at Low pH.

The summarized amalgam of internal relaxation modulations and external forces like pH, temperature, and solvent conditions determine the protein structure, stability, and function. In a free-energy landscape, although conformers are arranged in vertical hierarchy, there exist several adjacent parallel sets with conformers occupying equivalent energy cleft. Such conformational states are pre-requisites for the functioning of proteins that have oscillating environmental conditions. As these conformational changes have utterly small re-arrangements, nuclear magnetic resonance (NMR) spectroscopy is unique in elucidating the structure-dynamics-stability-function relationships for such conformations. Helicobacter pylori survives and causes gastric cancer at extremely low pH also. However, least is known as to how the genome of the pathogen is protected from reactive oxygen species (ROS) scavenging in the gut at low pH under acidic stress. In the current study, biophysical characteristics of H. pylori DNA binding protein (Hup) have been elucidated at pH 2 using a combination of circular dichroism, fluorescence, NMR spectroscopy, and molecular dynamics simulations. Interestingly, the protein was found to have conserved structural features, differential backbone dynamics, enhanced stability, and DNA binding ability at low pH as well. In summary, the study suggests the partaking of Hup protein even at low pH in DNA protection for maintaining the genome integrity.

Structural and thermodynamical insights into the binding and inhibition of FIH-1 by the N-terminal disordered region of Mint3

Mint3 is known to enhance aerobic ATP production, known as the Warburg effect, by binding to FIH-1. Since this effect is considered to be beneficial for cancer cells, the interaction is a promising target for cancer therapy. However, previous research has suggested that the interacting region of Mint3 with FIH-1 is intrinsically disordered, which makes investigation of this interaction challenging. Therefore, we adopted thermodynamic and structural studies in solution to clarify the structural and thermodynamical changes of Mint3 binding to FIH-1. First, using a combination of circular dichroism, nuclear magnetic resonance, and hydrogen/deuterium exchange–mass spectrometry (HDX-MS), we confirmed that the N-terminal half, which is the interacting part of Mint3, is mostly disordered. Next, we revealed a large enthalpy and entropy change in the interaction of Mint3 using isothermal titration calorimetry (ITC). The profile is consistent with the model that the flexibility of disordered Mint3 is drastically reduced upon binding to FIH-1. Moreover, we performed a series of ITC experiments with several types of truncated Mint3s, an effective approach since the interacting part of Mint3 is disordered, and identified amino acids 78 to 88 as a novel core site for binding to FIH-1. The truncation study of Mint3 also revealed the thermodynamic contribution of each part of Mint3 to the interaction with FIH-1, where the core sites contribute to the affinity (ΔG), while other sites only affect enthalpy (ΔH), by forming noncovalent bonds. This insight can serve as a foothold for further investigation of intrinsically disordered regions (IDRs) and drug development for cancer therapy.

Highly modified nor-clerodane diterpenoids from Croton yanhuii

Phytochemical investigation of the leaves and twigs of Croton yanhuii led to the isolation of seven highly modified nor-clerodane diterpenoids (1–7), including three new ones, croyanoids A-C (1–3), along with four known analogues (4–7). Compound 1 incorporates a 5,12-epoxy ring, forming a unique cage-like, 6/6/6/5-fused tetracyclic ring system. Their structures were established by extensive spectroscopic analysis, and the absolute configurations of 1–4 were determined by a combination of circular dichroism (CD) analysis and single-crystal X-ray diffraction. All compounds were tested in an array of bioassays, but were inactive. Crotoeurin A (7), a nor-clerodane dimer with a high yield of 0.2‰ isolated in current study, was considered as a chemotaxonomic marker for this species.

Self-referencing circular dichroism ion yield measurements for improved statistics using femtosecond laser pulses.

The combination of circular dichroism with laser mass spectrometry via the measurement of ion yields is a powerful tool in chiral recognition, but the measured anisotropies are generally weak. The method presented in this contribution reduces the measurement error significantly. A common path optical setup generates a pair of counter-rotating laser foci in the interaction region of a time-of-flight spectrometer. As the space focus condition is fulfilled for both foci individually, this becomes a twin-peak ion source with well separated and sufficiently resolved mass peaks. The individual control of polarization allows for in situ correction of experimental fluctuations measuring circular dichroism. Our robust optical setup produces reliable and reproducible results and is applicable for dispersion sensitive femtosecond laser pulses. In this contribution, we use 3-methyl-cyclopentanone as a prototype molecule to illustrate the evaluation procedure and the measurement principle.

Absolute configuration and host-guest binding of chiral porphyrin-cages by a combined chiroptical and theoretical approach

Porphyrin cage-compounds are used as biomimetic models and substrate-selective catalysts in supramolecular chemistry. In this work we present the resolution of planar-chiral porphyrin cages and the determination of their absolute configuration by vibrational circular dichroism in combination with density functional theory calculations. The chiral porphyrin-cages form complexes with achiral and chiral viologen-guests and upon binding one of the axial enantiomorphs of the guest is bound selectively, as is indicated by induced-electronic-dichroism-spectra in combination with calculations. This host-guest binding also leads to unusual enhanced vibrational circular dichroism, which is the result of a combination of phenomena, such as rigidification of the host and guest structures, charge transfer, and coupling of specific vibration modes of the host and guest. The results offer insights in how the porphyrin cage-compounds may be used to construct a future molecular Turing machine that can write chiral information onto polymer chains.

Structural ensemble and biological activity of DciA intrinsically disordered region

DciA is a newly discovered bacterial protein involved in loading the replicative helicase DnaB onto DNA at the initiation step of chromosome replication. Its three-dimensional structure is composed of a folded N-terminal domain (residues 1–111) resembling K Homology domains and a long disordered C-terminal tail (residues 112–157) which structure–activity relationship remains to be elucidated. In the present study on Vibrio cholerae DciA, we emphasize the importance of its disordered region to load DnaB onto DNA using surface plasmon resonance (SPR) and isothermal titration microcalorimetry (ITC). Then we characterize the conformational ensemble of the full-length protein using a combination of circular dichroism (CD), small angle X-ray scattering (SAXS), and molecular dynamics (MD) simulations. The atomic-level structural ensemble generated by MD simulations is in very good agreement with SAXS data. From initial conformations of the C-terminal tail without any secondary structure, our simulations bring to light several transient helical structures in this segment, which might be molecular recognition features (MoRFs) for the binding to DnaB and its recruitment and loading onto DNA.

Structural Analysis and Design of Chionodracine-Derived Peptides Using Circular Dichroism and Molecular Dynamics Simulations.

Antimicrobial peptides have been identified as one of the alternatives to the extensive use of common antibiotics as they show a broad spectrum of activity against human pathogens. Among these is Chionodracine (Cnd), a host-defense peptide isolated from the Antarctic icefish Chionodraco hamatus, which belongs to the family of Piscidins. Previously, we demonstrated that Cnd and its analogs display high antimicrobial activity against ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species). Herein, we investigate the interactions with lipid membranes of Cnd and two analogs, Cnd-m3 and Cnd-m3a, showing enhanced potency. Using a combination of Circular Dichroism, fluorescence spectroscopy, and all-atom Molecular Dynamics (MD) simulations, we determined the structural basis for the different activity among these peptides. We show that all peptides are predominantly unstructured in water and fold, preferentially as α-helices, in the presence of lipid vesicles of various compositions. Through a series of MD simulations of 400 ns time scale, we show the effect of mutations on the structure and lipid interactions of Cnd and its analogs. By explaining the structural basis for the activity of these analogs, our findings provide structural templates to design minimalistic peptides for therapeutics.

The acidic tail of HMGB1 regulates its secondary structure and conformational flexibility: A circular dichroism and molecular dynamics simulation study

High mobility group box 1 (HMGB1) is a damage-associated molecular pattern (DAMP) molecule that triggers the progression of several pro-inflammatory diseases such as diabetes, Alzheimer’s disease and cancer, by inducing signals upon interaction with the receptors such as the receptor for advanced glycation end-products (RAGE) and toll-like receptors (TLRs). The acidic C-terminal tail of HMGB1 is an intrinsically disordered region of the protein which is known to determine the interaction of HMGB1 to DNA and histones. This study characterizes its structural properties using a combination of circular dichroism (CD) and molecular dynamics (MD) simulations. The full-length and tail-less forms of HMGB1 were compared to rationalise the role of the acidic tail in maintaining the stability of the entire structure of HMGB1 in atomistic detail. Consistent with experimental data, the acidic tail was predicted to adopt an extended conformation that allows it to make a range of hydrogen-bonding and electrostatic interactions with the box-like domains that stabilize the overall structure of HMGB1. Absence of the acidic tail was predicted to increase structural fluctuations of all amino acids, leading to changes in secondary structure from α-helical to more hydrophilic turns along with increased exposure of multiple amino acids to the surrounding solvent. These structural changes reveal the intrinsic conformational dynamics of HMGB1 that are likely to affect the accessibility of its receptors.

Control of secondary structure and morphology of peptide–guanidiniocarbonylpyrrole conjugates by variation of the chain length

Peptide amphiphiles with well-organized secondary structure are an important family of molecules that are known to assemble into a variety of nanostructures. In this work, we present three guanidiniocarbonylpyrrole (GCP) containing peptide amphiphiles, which show versatile morphology and secondary structure changes as a result of different chain lengths and in different concentration regimes. The random coil conformation, α-helix, and β-sheet are obtained for peptide 1, peptide 2, and peptide 3, respectively under neutral aqueous conditions. Furthermore, all peptide amphiphiles can aggregate to form nanoparticles at low concentrations. However, at high concentrations, peptide 1 self-assembles into left-handed twisted helical fibers, while longer bamboo-like morphology can be observed exclusively for peptide 2. For peptide 3, freshly prepared samples show uniform spherical morphology, whereas an obvious morphological transition from original nanoparticles to disordered fibers was realized after incubating for one week. These fascinating morphology changes were determined by the combination of circular dichroism, dynamic light scattering, transmission electron microscopy, atomic force microscopy, and theoretical calculations.

α-Synuclein Spontaneously Adopts Stable and Reversible α-Helical Structure in Water-Less Environment.

A highly stable, spontaneous, and reversible α-helical-structure formation in recombinant and chemically modified α-synuclein protein is demonstrated for the first time in a water-less (1.5 % w/w H2 O) polymer surfactant environment. Using a combination of circular dichroism and ATR-FTIR spectroscopy, we show that whilst native α-synuclein in aqueous solution shows a predominant unordered conformation (≈64 %), mixing with polyethylene glycol based anionic polymer surfactant (PS) and removing water reveals a 25 % unordered, 25 % α-helical, and 27 % β-sheet structure. Interestingly, bioconjugation of native α-synuclein with a diamine molecule, to increase the positive charge on the protein chain, and subsequent electrostatic coupling with the PS forms a conjugate with a retained unordered structure. Removal of water from this system provides a highly stable α-helical (≈74 %) water-less liquid system. Surprisingly, the α-helical-to-unordered state transition is completely reversible and is achieved at ≈25-30 w/w% of water in the system. Moreover, the α-helix shows an extraordinary temporal stability (>6 months) in a waterless environment.

Zinc binding to Muscle LIM Protein regulates its structure and interaction with binding partners

Muscle LIM protein (MLP) is a member of the cysteine‐rich protein family, localising predominantly to the Z‐disk of the myofilaments in cardiac myocytes. MLP is a mechanosensor and functions through its translocation to the nucleus from the myofilaments and through protein‐protein interactions in the cytoplasm. Mechanosensing enables the heart to adapt appropriately to alterations in hemodynamic load, whilst mutations in the MLP gene lead to cardiomyopathy and heart failure. MLP contains two LIM domains each consisting of a double zinc‐finger motif. Rather than interacting with DNA, LIM domains mediate protein‐protein interactions associated with cellular signalling.The aim of this investigation is to determine how zinc binding regulates the structure of MLP and determine the impact on its interaction with binding partners. The analysis was performed using a combination of circular dichroism (CD), bioinformatics tools and online servers. CD is the difference in absorption between left‐handed and right‐handed circularly polarised light, occurring when a molecule contains light‐absorbing groups. It can be used to study the secondary, tertiary and quaternary structure of proteins, as well as studying its conformational stability under different conditions.In this study, we used CD to determine structural changes to MLP in the presence and absence of zinc. MLP is predominantly helical (~36%) with a small percentage of beta‐strands of ~8%, 34% of unordered and 21% of turns. In the presence of excess zinc, the helical content was reduced to ~19% with a gain of beta‐strand component to 30%. The presence of EDTA caused MLP to lose some helical conformation to 22% with an increased in the beta‐strand content to 16%. These data suggest that zinc increases the structural folding and organization of MLP.The full length wildtype MLP sequence was submitted to a variety of servers along with the C58G mutation known to reduce zinc binding in the first LIM domain. This mutation in humans leads to heart failure. Heart failure is defined as a progressive condition in which the heart is unable to pump enough blood to meet the body's needs for oxygen and nutrients. Bioinformatic protein‐protein analysis indicated that the C58G mutation inhibits interaction with NRAP, TCAP, alpha‐actinin and cofilin 2 which would interfere with MLP binding to the z‐disk and the myofilaments within cardiac myocytes. This would have a significant negative impact on mechanosensing in the heart and explains why the C58G mutation in MLP leads to heart failure.Support or Funding InformationUniversity of Reading and Diamond Light SourceThis abstract is from the Experimental Biology 2019 Meeting. There is no full text article associated with this abstract published in The FASEB Journal.

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences

BackgroundMitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro. MethodsThe combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants. ResultsThis study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA. ConclusionsSingle-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro. General significanceWe illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation.